Phospho-STK11 (T189) Antibody

1. WIPI3 and WIPI4 beta-propellers have roles as scaffolds for LKB1-AMPK-TSC signalling circuits in the control of autophagy PMID: 28561066
2. The function of human LKB1 depends on membrane binding.LKB1 is down-regulated in malignant melanoma. PMID: 28649994
3. LKB1 expression was abnormally reduced in >80% of gallbladder carcinoma (GBC) tissues, and that the downregulation of LKB1 mRNA expression was associated with the poor prognosis of patients with GBC. PMID: 30015925
4. Low LKB1 expression is associated with prostate cancer. PMID: 29566977
5. Decreases in LKB1 expression by HBx protein-mediated p53 inactivation may play an important role in HBV-associated hepatocellular tumorigenesis. PMID: 29475611
6. LKB1 performed as a tumor suppressor in lung cancer inhibiting proliferation of lung cancer cells and inducing their apoptosis. LKB1 also inhibited the in vivo growth of lung cancer. After treatment with cyclopamine, the activated Shh signaling pathway induced by LKB1 silencing was suppressed, and the inactivated Shh signaling pathway induced by LKB1 over-expression was enhanced. PMID: 29573522
7. Cytoplasmic LKB1 promotes the growth of lung adenocarcinoma and could be a prognostic marker for lung adenocarcinoma. PMID: 30033530
8. Here we report a novel frameshift mutation of STK11 in a Chinese Peutz-Jeghers syndrome family. PMID: 29301733
9. findings demonstrate that LKB1 plays an important role in the maintenance of LSCs, which may be responsible for drug resistance and AML relapse PMID: 28397012
10. STK11 mutation found in duodenal adenomas/adenocarcinoma highlight the importance of proteins encoded by these genes in tumor development. PMID: 29525853
11. Study revealed a new role for LKB1 in promoting cell motility by downregulating migration-suppressing miRNA expression and exosome secretion. PMID: 29138862
12. In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. PMID: 29191602
13. Study found that ablation of Lkb1 in adipocytes induced inflammation and macrophage invasion in sciatic nerves, leading to severe sciatic axon abnormality and hindlimb paralysis. PMID: 29032027
14. Data indicate that LKB1 is a potential suppressor of metastasis of pancreatic ductal carcinoma (PDC). Furthermore, results demonstrate that LKB1 promotes Snail protein degradation though enhancing interaction between E3 ligase FBXL14 and Snail to increase Snail ubiquitination. PMID: 29601127
15. Ex vivo models showed that MDA-MB-231, a mesenchymal tumor cell line, grew in suspension only if LKB1 was upregulated, but the MCF-7 epithelial cell line lost its ability to generate spheroids and colonies when LKB1 was inhibited, supporting the idea that LKB1 might be necessary for circulating tumor cells to overcome the absence of the extracellular matrix during the early phases of intravasation. PMID: 28700115
16. we speculate that YAP/TAZ in dependent of FOS may promote DNMT1 and subsequently mediate DNMT1-G9A complex involving serine metabolism and the methylation of DNA and histone. We hope that our study will stimulate further studies and a new targeted therapy and early medical intervention for YAP/TAZ could be a useful option for breast cancer cases complicated with LKB1 deficiency. PMID: 28931725
17. Results show that STK11 mutation is a biomarker for responsiveness to cardiac glycosides (CGs). PMID: 27431571
18. Data suggest that the hereditary Peutz-Jeghers syndrome (PJS) in the family may be attributed to the serine/threonine kinase 11 (STK11) gene missense mutation detected in both daughter and mother. PMID: 29419869
19. LKB1 expression promoted an adaptive response to energy stress induced by anchorage-independent growth. Finally, this diminished adaptability sensitized LKB1-deficient cells to combinatorial inhibition of mitochondrial complex I and glutaminase. PMID: 28034771
20. these data uncover that ADIPOQ/adiponectin induces autophagic cell death in breast cancer and provide in vitro and in vivo evidence for the integral role of STK11/LKB1-AMPK-ULK1 axis in ADIPOQ/adiponectin-mediated cytotoxic autophagy. PMID: 28696138
21. Our data hint at a possible predictive impact of LKB1 expression in patients with aNSCLC treated with chemotherapy plus bevacizumab. PMID: 28119362
22. Our results indicate that LKB1 Phe354Leu polymorphism may play an important role in leukemogenesis and represents a poor prognostic factor. PMID: 28882949
23. we have demonstrated a novel function of LKB1 in DNA damage response. Cancer cells lacking LKB1 are more susceptible to DNA damage-based therapy and, in particular, to drugs that further impair DNA repair, such as PARP inhibitors. PMID: 27705915
24. LKB1 overexpression inhibited apoptosis and activated autophagy of Eca109 cells following radiation treatment, as determined by flow cytometry and western blot analyses. PMID: 28656285
25. In this study, compound heterozygous variants of LKB1, c.890G > A/ c.1062C > G and del(exon1)/ c.1062C > G, were identified in two sporadic Chinese Peutz-Jeghers syndrome cases PMID: 28185117
26. By downregulating acetylated LKB1 protein via HERC2, SIRT1 fine-tunes the crosstalk between endothelial and vascular smooth muscle cells to prevent adverse arterial remodeling and maintain vascular homeostasis PMID: 27259994
27. Data indicate that nesfatin-1/NUCB-2 enhanced migration, invasion and epithelial-mesenchymal transition (EMT) in colon cancer cells through LKB1/AMPK/TORC1/ZEB1 pathways in vitro and in vivo. PMID: 27150059
28. STK11 sequence deletions and point mutations were found in 11 Chinese children with Peutz-Jeghers syndrome. PMID: 27467201
29. define a CIII-PI3K-regulated endosomal signalling platform from which LKB1 directs epithelial polarity, the dysregulation of which endows LKB1 with tumour-promoting properties PMID: 29084199
30. Structure of the complex of phosphorylated liver kinase B1 and 14-3-3zeta has been reported. PMID: 28368277
31. a novel de-novo germline mutation is associated with Peutz-Jeghers syndrome and elevated cancer risk PMID: 29141581
32. STK11 mutation is associated with Lung Adenocarcinoma. PMID: 26917230
33. Case Report: novel heterozygous mutation (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG,p.S142SfsX13) in the STK11 gene causing PJS in a Chinese female without a Peutz-Jeghers syndrome family history. PMID: 28986664
34. Low LKB1 expression is associated with non-small cell lung cancer. PMID: 28652249
35. Macrophage LKB1 reduction caused by oxidized low-density lipoprotein promotes foam cell formation and the progression of atherosclerosis. PMID: 28827412
36. CPS1 maintains pyrimidine pools and DNA synthesis in KRAS/LKB1-mutant lung cancer cells PMID: 28538732
37. All together our results show that STK11ex1-2 mutations delineate an aggressive subtype of lung cancer for which a targeted treatment through STK11 inhibition might offer new opportunities. PMID: 26625312
38. Low LKB1 expression is associated with HPV-associated cervical cancer progression. PMID: 27546620
39. Mutations in TP53 and STK11 also impacted tumor biology regardless of KRAS status, with TP53 strongly associated with enhanced proliferation and STK11 with suppression of immune surveillance. These findings illustrate the remarkably distinct ways through which tumor suppressor mutations may contribute to heterogeneity in KRAS-mutant tumor biology. PMID: 26477306
40. Studies indicate that the serine-threonine kinase 11 (Peutz-Jeghers syndrome) LKB1 gene is somatically mutated in female reproductive tract cancers. PMID: 27910069
41. Our results indicate that HPV16 E6/E7 indirectly upregulated the expression of VEGF by inhibition of liver kinase B1 expression and upregulation of hypoxia-inducible factor 2alpha expression,thus propose a human papillomavirus-liver kinase B1-hypoxia-inducible factor 2A-vascular endothelial growth factor axis for the tumorigenesis of lung cancer PMID: 28720067
42. The expression of LKB1 is down-regulated in most of the lung cell lines. PMID: 28031112
43. Genetic variability at STK11 locus is associated with coronary artery disease risk in type 2 diabetes in the Chinese population. PMID: 28349069
44. pregulation of PTEN and LKB1 in concert with negative or low levels of activated Akt, mTOR and S6 indicates that PI3K/Akt/mTOR pathway may not play a significant role in pathogenesis of leiomyoma. PMID: 27748285
45. Data provide evidence for three novel mutations and three recurrent mutations in STK11 were identified in Chinese families with Peutz-Jeghers syndrome, which further broaden the mutation spectrum of STK11. PMID: 27821076
46. The mutation detection rate for the LKB1 gene was 85.7% in our Chinese familial Peutz-Jeghers Syndrome and 63.2% in all Chinese Peutz-Jeghers Syndrome patients. The amplification and sequencing results of the flanking sequences presented 3 kinds of polymorphisms in introns of LKB1 gene: (c.374+24G>T, c.464+47_48inGGGGGCC, and c.920+7G>C). PMID: 27721366
47. STK11 mutation in gastric in gastric-type endocervical adenocarcinoma is associated with worse prognosis. PMID: 27241107
48. identification of a network linking metabolic and epigenetic alterations that is central to oncogenic transformation downstream of the liver kinase B1 (LKB1, also known as STK11) tumour suppressor, an integrator of nutrient availability, metabolism and growth PMID: 27799657
49. Severely compromised endogenous LKB1 expression in the L02 cell line may confer to L02 cells tumor-initiating capacities. PMID: 27349837
50. AMPK exerts multiple actions on TGF-beta signaling and supports that AMPK can serve as a therapeutic drug target for breast cancer PMID: 26718214

显示更多

收起更多

HGNC: 11389

OMIM: 175200

KEGG: hsa:6794

STRING: 9606.ENSP00000324856

UniGene: Hs.515005