HMBS Antibody

1. In a Chinese female patient with very typical Acute intermittent porphyria symptoms, a heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. PMID: 30212967
2. Human hydroxymethylbilane synthase: Molecular dynamics of the pyrrole chain elongation identifies step-specific residues that cause acute intermittent porphyria. PMID: 29632172
3. After a diagnostic odyssey, his urine porphobilinogen was found to be significantly elevated and genetic testing showed a previously unreported consensus splice-site mutation IVS4-1G>A in the HMBS gene confirming the diagnosis of Acute Intermittent Porphyria (AIP) PMID: 27769855
4. The s describe the biochemical characterisation of expressed HMBS mutants in a black South African population. This reveals insight into the mechanism of catalytic activity loss, which may inspire investigation into individualised therapy based on the molecular lesion identified. PMID: 27849156
5. ALAS1 mRNA and activity were elevated approximately ~3- and 5-fold, and HMB synthase activity was approximately half-normal (~42%) PMID: 26062020
6. A new mutation in intron 2 (IVS2-2Ag-->G) was identified in a Chinese family with acute intermittent porphyria. PMID: 26228342
7. in the hepatic cancer tissue of two acute porphyria patients, somatic second-hit mutations result in nearly complete inactivation of PPOX and HMBS PMID: 25445397
8. study of hydroxymethylbilane synthase mutations and polymorphisms in Brazilian families with acute intermittent porphyria PMID: 25703257
9. Letter/Case Report: R173W mutation of HMBS gene can cause rhabdomyolysis in patients with variant acute intermittent porphyria. PMID: 25389600
10. we report a novel PBGD missense mutation. PMID: 25870942
11. Novel porphobilinogen deaminase gene mutations have been described in Polish patients with non-erythroid acute intermittent porphyria. PMID: 25923088
12. Conformational stability and activity of hydroxymethylbilane synthase (HMSB) and the acute intermittent porphyria K132N and V215E HMSB mutations. PMID: 23815679
13. Dense geographic aggregation with one identical haplotype strongly suggests a remote founder phenomenon for these Venezuelan acute intermittent porphyria families, carrying an unreported but most frequent HMBS mutation. PMID: 20978940
14. Findings indicate that using TATA-binding protein (TBP) alone or in combination with hydroxymethylbilane synthase (HMBS) as endogenous controls could be a reliable method for normalizing qRT-PCR data in hepatoma cell lines treated with TNF-alpha. PMID: 23811755
15. The novel mutations of HMBS gene were three missense (R26L, R173G and D178H), two frameshift (c.749_765dup and c.874insC) and one intronic deletion (IVS12+3_+11delAGGGCCTGT). PMID: 19656452
16. The informative SNPs of HMBS gene reveal a distinctive haplotype which segregates with the R116W mutation present in the Dutch AIP families (-64T, 1345 G, 2479 G, 3581 G, 6479 T, 7064 C and 8578 A). PMID: 19656453
17. One small deletion and six nucleotide substitutions within the 5'UTR and the housekeeping promoter of HMBS gene are found responsible for the non-erythroid form of acute intermittent porphyria. PMID: 22748422
18. Two novel porphobilinogen deaminase mutations have been identified in acute intermittent porphyria patients with accompanying anemia in mainland China. PMID: 21669542
19. We identified a monoallelic missense mutation p.Arg201Gly (c.601CNG)in HMBS gene in the patient with Lichen sclerosus et atrophicus-like skin lesions. PMID: 20580577
20. Molecular genetic study of acute intermittent porphyria in Russia: mutation analysis and functional polymorphism search in porphobilinogen deaminase gene PMID: 20536026
21. Acute intermittent porphyria: novel missense mutations in the human hydroxymethylbilane synthase gene PMID: 11399210
22. In Italy, molecular analysis of the HMBS gene in acute intermittent porphyria patients and in family members of Italian ancestry identified 13 different mutations among 14 patients; 7 are new findings. PMID: 11831862
23. 40% of all mutations identified among the Polish acute intermittent porphyria (AIP)patients in this study are novel, indicating the heterogeneity of molecular defects causing AIP. PMID: 11857754
24. A novel mutation of the PBGD gene has been identified in a patient with acute intermittent porphyria presenting with severe and bilateral axonal radial motor neuropathy. PMID: 11940707
25. A mutation that results in an inactive holo-protein that exists as a complex with two substrate molecules covalently bound to the dipyrromethane cofactor arising from the reaction between the apo-protein and pre-uroporphyrinogen PMID: 12773194
26. Modulation of penetrance by the wild-type allele in dominantly inherited erythrohepatic and acute hepatic porphyrias was studied using HMBS. PMID: 14669009
27. screening of the DNA of 20 unrelated individuals revealed 20 different mutations, 11 of which had not been reported previously; the novel mutations affected intron 1, exon 5, intron 6, intron 7, intron 9, intron 13 , exon 15. PMID: 15003823
28. recurrent mutations G111R and R173Q occur at CpG motifs in the porphobilinogen deaminase gene in acute intermittent porphyria patients PMID: 15669678
29. Three novel mutations within the HMBS gene are associated with acute intermittent porphyria. PMID: 16211556
30. Sequencing of the hydroxymethylbilane synthase and uroporphyrinogen decarboxylase genes confirmed the relatively rare diagnosis of dual porphyria, and revealed a novel uroporphyrinogen decarboxylase mutation PMID: 16390615
31. the R173W mutation may have a role in acute intermittent porphyria PMID: 16817012
32. We demonstrate that the PBGD cellular pool is controlled by the proteasome activity, which in turn is down regulated by hemin or up-regulated by Pb-ALAD. PMID: 16935474
33. the search for mutations identified among Slavic acute intermittent porphyria patients 65 such mutations were found and concluded that there is not a distinct predominance of certain mutations in Slavs PMID: 17298216
34. Identification of a nonsense mutation in the porphobilinogen deaminase gene on chromosome 11q23.3, which harbors the mutations causing acute intermittent porphyria, as the underlying genetic defect in Chester porphyria. PMID: 17298217
35. The motor neuropathy showed a steady and gradual improvement following the hematin treatment. Molecular analysis of the porphobilinogen deaminase gene revealed a short segment deletion. PMID: 17459418
36. Molecular analyses of the PBGD gene revealed a novel mutation in exon 15, the 973insG. PMID: 18070416
37. A mother and two children had a C insertion in exon 14 resulting in acute intermittent porphyria. PMID: 18405488
38. Recombinant T59I and V215M had residual activity of 80.6% and 19.4%, respectively, of that of the wild type enzyme. PMID: 18406650
39. 12-bp deletion mutation resulting in a 4-amino acid (AA) deletion from AA positions 337 to 340 found in patient and two family members PMID: 18554962
40. Molecular analysis of twenty-four unrelated Chinese acute intermittent porphyria patients from Taiwan identified twenty-five HMBS mutations. There were 10 missense (40%), four nonsense (16%), five frame-shift (20%) and six splice site (24%) mutations. PMID: 18627369
41. structure provides insights into the mechanism of action of PBGD at the molecular level and could aid the development of potential drugs for the up-regulation of PBGD activity in acute intermittent porphyria PMID: 18936296
42. The decrease in the expression of ubiquitous HMBS and UROS mRNAs under hypoxia is associated with accumulation of hypoxia-inducible factor 1alpha protein. PMID: 19021769
43. 6 mutations in exons common to housekeeping & erythroid-specific isoforms were evaluated at the structural level based on the 3-D structure of the E. coli enzyme. The new missense c.95G>C(p.R32P) is the 1st de novo mutation in the Israeli AIP population. PMID: 19138865
44. structure of the human uPBGD (ubiquitous PBGD) mutant, R167Q, that has been determined by X-ray crystallography and refined to 2.8 A PMID: 19207107
45. Molecular analyses of the hydroxymethylbilane synthase gene revealed seven mutations, in Acute intermittent porphyria PMID: 19292878

显示更多

收起更多

HGNC: 4982

OMIM: 176000

KEGG: hsa:3145

STRING: 9606.ENSP00000278715

UniGene: Hs.82609